Search our product database

Search options:
Product name: hSEC13 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15213-1
Sigma Product ID: EHU152131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000157020
Ensembl Transcript ID: ENST00000337354, ENST00000350697, ENST00000383801, ENST00000397109, ENST00000479868
Gene coordinates (GRCh38): 3:10293131-10321178
HGNC Alias: D3S1231E, npp-20, SEC13L1, SEC13R
HGNC ID: HGNC:10697
HGNC Symbol: SEC13
NCBI gene: 6396
RefSeq mRNA: NM_001136026, NM_001136232, NM_030673, NM_183352
Sequence:CGTGTGTTCATTTGGACCTGTGATGATGCCTCAAGCAATACGTGGTCCCCTAAAT
TGTTGCACAAGTTCAACGATGTGGTGTGGCATGTGAGCTGGTCCATCACAGCCAA
CATCCTGGCTGTCTCTGGTGGAGACAATAAGGTGACCCTGTGGAAGGAGTCAGTT
GATGGGCAGTGGGTGTGCATCAGTGATGTCAACAAGGGCCAGGGCTCCGTATCAG
CATCAGTGACAGAGGGCCAGCAGAACGAGCAGTGACAAGACAGGTGGGGCCTGGC
TCCCCACCCGCCAGCTCCAGGACTGCCCCTTCCTGGGCCAACTAACCAGACAACT
GGGAAGAGCCCCCAACTCCAACAGGATTATTTTCCCAGGAGGAGTTACAGATGCA
GCCACAGATTGATCA
Product name: hSEC13 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15213-1
Sigma Product ID: EHU152131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000157020
Ensembl Transcript ID: ENST00000337354, ENST00000350697, ENST00000383801, ENST00000397109, ENST00000479868
Gene coordinates (GRCh38): 3:10293131-10321178
HGNC Alias: D3S1231E, npp-20, SEC13L1, SEC13R
HGNC ID: HGNC:10697
HGNC Symbol: SEC13
NCBI gene: 6396
RefSeq mRNA: NM_001136026, NM_001136232, NM_030673, NM_183352
Sequence:CGTGTGTTCATTTGGACCTGTGATGATGCCTCAAGCAATACGTGGTCCCCTAAAT
TGTTGCACAAGTTCAACGATGTGGTGTGGCATGTGAGCTGGTCCATCACAGCCAA
CATCCTGGCTGTCTCTGGTGGAGACAATAAGGTGACCCTGTGGAAGGAGTCAGTT
GATGGGCAGTGGGTGTGCATCAGTGATGTCAACAAGGGCCAGGGCTCCGTATCAG
CATCAGTGACAGAGGGCCAGCAGAACGAGCAGTGACAAGACAGGTGGGGCCTGGC
TCCCCACCCGCCAGCTCCAGGACTGCCCCTTCCTGGGCCAACTAACCAGACAACT
GGGAAGAGCCCCCAACTCCAACAGGATTATTTTCCCAGGAGGAGTTACAGATGCA
GCCACAGATTGATCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.