Search our product database

Search options:
Product name: hNR2C2AP €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15381-1
Sigma Product ID: EHU153811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184162
Ensembl Transcript ID: ENST00000331552, ENST00000420605, ENST00000537399, ENST00000538165, ENST00000539693
Gene coordinates (GRCh38): 19:19201416-19203424
HGNC Alias: TRA16
HGNC ID: HGNC:30763
HGNC Symbol: NR2C2AP
NCBI gene: 126382
RefSeq mRNA: NM_001300945, NM_176880
Sequence:GATTGATCGAGGCGACATTTAGGACTGGGGTGGGCGAGGGAGTGGCGGTTCTCGT
CCCAAGTTACAGGTGAGGACGTTCAGGCCAAGGCGTAGCCAAGATCGCGCCGCCC
TGTAGCTTGAGGAGGCGCCGGGATTCGAACCAAGGCTGTGCCCAATCCTAAGCCC
TGCGAGGTCTTGTGGAACCGACATGACCCACTCTTTGGTTTGTCCAGAGACAGTG
AGCAGGGTGAGTTCAGTGCTGAATCGCAACACTCGGCAGTTTGGAAAAAAACATC
TTTTCGACCAGGATGAGGAGACATGTTGGAACTCAGACCAGGGCCCCTCCCAGTG
GGTGACGCTGGAGTTTCCCCAGCTCATCCGTGTCTCCCAGCTGCAGATCCAGTTT
CAGGGTGGCTTCTCCAGTCGCCGGGGCTGCCTGGAAGGTTCACAGGGCACTCAG
Product name: hNR2C2AP €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15381-1
Sigma Product ID: EHU153811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000184162
Ensembl Transcript ID: ENST00000331552, ENST00000420605, ENST00000537399, ENST00000538165, ENST00000539693
Gene coordinates (GRCh38): 19:19201416-19203424
HGNC Alias: TRA16
HGNC ID: HGNC:30763
HGNC Symbol: NR2C2AP
NCBI gene: 126382
RefSeq mRNA: NM_001300945, NM_176880
Sequence:GATTGATCGAGGCGACATTTAGGACTGGGGTGGGCGAGGGAGTGGCGGTTCTCGT
CCCAAGTTACAGGTGAGGACGTTCAGGCCAAGGCGTAGCCAAGATCGCGCCGCCC
TGTAGCTTGAGGAGGCGCCGGGATTCGAACCAAGGCTGTGCCCAATCCTAAGCCC
TGCGAGGTCTTGTGGAACCGACATGACCCACTCTTTGGTTTGTCCAGAGACAGTG
AGCAGGGTGAGTTCAGTGCTGAATCGCAACACTCGGCAGTTTGGAAAAAAACATC
TTTTCGACCAGGATGAGGAGACATGTTGGAACTCAGACCAGGGCCCCTCCCAGTG
GGTGACGCTGGAGTTTCCCCAGCTCATCCGTGTCTCCCAGCTGCAGATCCAGTTT
CAGGGTGGCTTCTCCAGTCGCCGGGGCTGCCTGGAAGGTTCACAGGGCACTCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.