Search our product database

Search options:
Product name: hEP300 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15515-1
Sigma Product ID: EHU155151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100393
Ensembl Transcript ID: ENST00000263253
Gene coordinates (GRCh38): 22:41091786-41180079
HGNC Alias: KAT3B, p300
HGNC ID: HGNC:3373
HGNC Symbol: EP300
NCBI gene: 2033
RefSeq mRNA: NM_001429
Sequence:ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGC
TTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGA
GGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTT
GAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAA
TTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATT
ATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCA
GGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGAC
TACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAAT
TGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG
Product name: hEP300 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15515-1
Sigma Product ID: EHU155151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100393
Ensembl Transcript ID: ENST00000263253
Gene coordinates (GRCh38): 22:41091786-41180079
HGNC Alias: KAT3B, p300
HGNC ID: HGNC:3373
HGNC Symbol: EP300
NCBI gene: 2033
RefSeq mRNA: NM_001429
Sequence:ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGC
TTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGA
GGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTT
GAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAA
TTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATT
ATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCA
GGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGAC
TACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAAT
TGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.