Search our product database

Search options:
Product name: hFOXA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15581-1
Sigma Product ID: EHU155811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000129514
Ensembl Transcript ID: ENST00000250448, ENST00000545425
Gene coordinates (GRCh38): 14:37589984-37596059
HGNC Alias: HNF3A
HGNC ID: HGNC:5021
HGNC Symbol: FOXA1
NCBI gene: 3169
RefSeq mRNA: NM_004496
Sequence:GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCC
TCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGC
ACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCT
CATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCA
CTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCG
CCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTA
CCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGG
GGTTTGTCTGGCATAGCCAT
Product name: hFOXA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15581-1
Sigma Product ID: EHU155811
Species: Homo sapiens
Ensembl Gene ID: ENSG00000129514
Ensembl Transcript ID: ENST00000250448, ENST00000545425
Gene coordinates (GRCh38): 14:37589984-37596059
HGNC Alias: HNF3A
HGNC ID: HGNC:5021
HGNC Symbol: FOXA1
NCBI gene: 3169
RefSeq mRNA: NM_004496
Sequence:GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCC
TCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGC
ACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCT
CATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCA
CTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCG
CCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTA
CCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGG
GGTTTGTCTGGCATAGCCAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.