Search our product database

Search options:
Product name: hNCAPG €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15616-1
Sigma Product ID: EHU156161
Species: Homo sapiens
Ensembl Gene ID: ENSG00000109805
Ensembl Transcript ID: ENST00000251496
Gene coordinates (GRCh38): 4:17810902-17844862
HGNC Alias: CAP-G, FLJ12450, hCAP-G, YCG1
HGNC ID: HGNC:24304
HGNC Symbol: NCAPG
NCBI gene: 64151
RefSeq mRNA: NM_022346
RefSeq ncRNA: NR_073124
Sequence:TGATGAATGCCCAGTGGTTAATGCATATGCTACTTTGATTGAAAATGATTCAAAT
CCAGAAGTTAGACGGGCAGTGTTATCATGTATTGCACCATCAGCAAAGACTTTGC
CAAAAATTGTAGGGCGCACCAAGGATGTGAAAGAGGCTGTCAGAAAGCTGGCTTA
TCAGGTTTTAGCTGAAAAGGTTCATATGAGAGCTATGTCCATTGCTCAGAGAGTA
ATGCTCCTTCAACAAGGTCTTAATGACAGATCAGATGCTGTGAAACAAGCTATGC
AGAAGCATCTTCTTCAAGGCTGGTTACGGTTCTCTGAAGGAAATATCTTAGAGTT
GCTCCATCGGTTGGATGTAGAAAATTCTTCTGAAGTGGCAGTCTCTGTTCTCAAT
GCCTTGTTTTCAATAACTCCTCTCAGTGAACTGGTGGGACTCTGTAAAAACAATG
ATGGCAGGAAATTGA
Product name: hNCAPG €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15616-1
Sigma Product ID: EHU156161
Species: Homo sapiens
Ensembl Gene ID: ENSG00000109805
Ensembl Transcript ID: ENST00000251496
Gene coordinates (GRCh38): 4:17810902-17844862
HGNC Alias: CAP-G, FLJ12450, hCAP-G, YCG1
HGNC ID: HGNC:24304
HGNC Symbol: NCAPG
NCBI gene: 64151
RefSeq mRNA: NM_022346
RefSeq ncRNA: NR_073124
Sequence:TGATGAATGCCCAGTGGTTAATGCATATGCTACTTTGATTGAAAATGATTCAAAT
CCAGAAGTTAGACGGGCAGTGTTATCATGTATTGCACCATCAGCAAAGACTTTGC
CAAAAATTGTAGGGCGCACCAAGGATGTGAAAGAGGCTGTCAGAAAGCTGGCTTA
TCAGGTTTTAGCTGAAAAGGTTCATATGAGAGCTATGTCCATTGCTCAGAGAGTA
ATGCTCCTTCAACAAGGTCTTAATGACAGATCAGATGCTGTGAAACAAGCTATGC
AGAAGCATCTTCTTCAAGGCTGGTTACGGTTCTCTGAAGGAAATATCTTAGAGTT
GCTCCATCGGTTGGATGTAGAAAATTCTTCTGAAGTGGCAGTCTCTGTTCTCAAT
GCCTTGTTTTCAATAACTCCTCTCAGTGAACTGGTGGGACTCTGTAAAAACAATG
ATGGCAGGAAATTGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.