Search our product database

Search options:
Product name: hSTX7 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15627-1
Sigma Product ID: EHU156271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000079950
Ensembl Transcript ID: ENST00000367937, ENST00000367941, ENST00000448348
Gene coordinates (GRCh38): 6:132445867-132513198
HGNC ID: HGNC:11442
HGNC Symbol: STX7
NCBI gene: 8417
RefSeq mRNA: NM_001326578, NM_001326579, NM_001326580, NM_003569
RefSeq ncRNA: NR_137169
Sequence:GGCCCAGAGGATCTCTTCTAACATCCAGAAGATCACACAGTGTTCTGTGGAAATA
CAAAGAACTCTGAATCAACTTGGAACACCTCAAGATTCACCTGAATTGAGGCAAC
AGTTGCAACAGAAGCAGCAGTATACTAACCAGCTTGCCAAAGAAACAGATAAGTA
CATTAAAGAGTTTGGATCTCTGCCCACCACCCCCAGTGAACAGCGTCAAAGGAAA
ATACAGAAGGATCGCTTAGTGGCAGAGTTCACAACATCACTGACAAACTTCCAGA
AGGTCCAGAGGCAGGCTGCTGAGCGAGAGAAAGAGTTTGTTGCTCGAGTAAGAGC
CAGTTCCAGAGTGTCTGGCAGTTTTCCTGAGGACAGCTCAAAAGAAAGGAATCTT
GTATCCTGGGAAAGCCA
Product name: hSTX7 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15627-1
Sigma Product ID: EHU156271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000079950
Ensembl Transcript ID: ENST00000367937, ENST00000367941, ENST00000448348
Gene coordinates (GRCh38): 6:132445867-132513198
HGNC ID: HGNC:11442
HGNC Symbol: STX7
NCBI gene: 8417
RefSeq mRNA: NM_001326578, NM_001326579, NM_001326580, NM_003569
RefSeq ncRNA: NR_137169
Sequence:GGCCCAGAGGATCTCTTCTAACATCCAGAAGATCACACAGTGTTCTGTGGAAATA
CAAAGAACTCTGAATCAACTTGGAACACCTCAAGATTCACCTGAATTGAGGCAAC
AGTTGCAACAGAAGCAGCAGTATACTAACCAGCTTGCCAAAGAAACAGATAAGTA
CATTAAAGAGTTTGGATCTCTGCCCACCACCCCCAGTGAACAGCGTCAAAGGAAA
ATACAGAAGGATCGCTTAGTGGCAGAGTTCACAACATCACTGACAAACTTCCAGA
AGGTCCAGAGGCAGGCTGCTGAGCGAGAGAAAGAGTTTGTTGCTCGAGTAAGAGC
CAGTTCCAGAGTGTCTGGCAGTTTTCCTGAGGACAGCTCAAAAGAAAGGAATCTT
GTATCCTGGGAAAGCCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.