Search our product database

Search options:
Product name: hCSNK2A1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15685-1
Sigma Product ID: EHU156851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101266
Ensembl Transcript ID: ENST00000217244, ENST00000349736, ENST00000400217, ENST00000400227, ENST00000642689, ENST00000643641, ENST00000643660, ENST00000643700, ENST00000643980, ENST00000644003, ENST00000644170, ENST00000644448, ENST00000644710, ENST00000645234, ENST00000645249, ENST00000645260, ENST00000645623, ENST00000645768, ENST00000645840, ENST00000645910, ENST00000646305, ENST00000646477, ENST00000646561, ENST00000646814, ENST00000647155, ENST00000647348
Gene coordinates (GRCh38): 20:472498-543835
HGNC Alias: Cka1, Cka2
HGNC ID: HGNC:2457
HGNC Symbol: CSNK2A1
NCBI gene: 1457
RefSeq mRNA: NM_001362770, NM_001362771, NM_001895, NM_177559, NM_177560
Sequence:AGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGT
CAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGAC
TGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CCCGATACTTCAAAGGTCCTGAGCTACTTGTAGACTATCAGATGTACGATTATAG
TTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTTCGGAAGGAG
CCATTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTC
TGGGGACAGAAGATTTATATGACTATATTGACAAATACAACATTGAATTAGATCC
ACGTTTCAATGATATCTTGGGCAGACACTCTCG
Product name: hCSNK2A1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15685-1
Sigma Product ID: EHU156851
Species: Homo sapiens
Ensembl Gene ID: ENSG00000101266
Ensembl Transcript ID: ENST00000217244, ENST00000349736, ENST00000400217, ENST00000400227, ENST00000642689, ENST00000643641, ENST00000643660, ENST00000643700, ENST00000643980, ENST00000644003, ENST00000644170, ENST00000644448, ENST00000644710, ENST00000645234, ENST00000645249, ENST00000645260, ENST00000645623, ENST00000645768, ENST00000645840, ENST00000645910, ENST00000646305, ENST00000646477, ENST00000646561, ENST00000646814, ENST00000647155, ENST00000647348
Gene coordinates (GRCh38): 20:472498-543835
HGNC Alias: Cka1, Cka2
HGNC ID: HGNC:2457
HGNC Symbol: CSNK2A1
NCBI gene: 1457
RefSeq mRNA: NM_001362770, NM_001362771, NM_001895, NM_177559, NM_177560
Sequence:AGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGT
CAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGAC
TGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CCCGATACTTCAAAGGTCCTGAGCTACTTGTAGACTATCAGATGTACGATTATAG
TTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTTCGGAAGGAG
CCATTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTC
TGGGGACAGAAGATTTATATGACTATATTGACAAATACAACATTGAATTAGATCC
ACGTTTCAATGATATCTTGGGCAGACACTCTCG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.