Search our product database

Search options:
Product name: hFLNA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15778-1
Sigma Product ID: EHU157781
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196924
Ensembl Transcript ID: ENST00000360319, ENST00000369850, ENST00000369856, ENST00000420627, ENST00000422373, ENST00000610817
Gene coordinates (GRCh38): X:154348524-154374638
HGNC Alias: ABP-280, FLN, FLN1, OPD1, OPD2
HGNC ID: HGNC:3754
HGNC Symbol: FLNA
NCBI gene: 2316
RefSeq mRNA: NM_001110556, NM_001456
Sequence:GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGG
CTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCC
CATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGC
CCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAA
ATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAA
GGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACA
GTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAG
GGGATCCCATCCCTAAGAGCCCTTTC
Product name: hFLNA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15778-1
Sigma Product ID: EHU157781
Species: Homo sapiens
Ensembl Gene ID: ENSG00000196924
Ensembl Transcript ID: ENST00000360319, ENST00000369850, ENST00000369856, ENST00000420627, ENST00000422373, ENST00000610817
Gene coordinates (GRCh38): X:154348524-154374638
HGNC Alias: ABP-280, FLN, FLN1, OPD1, OPD2
HGNC ID: HGNC:3754
HGNC Symbol: FLNA
NCBI gene: 2316
RefSeq mRNA: NM_001110556, NM_001456
Sequence:GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGG
CTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCC
CATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGC
CCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAA
ATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAA
GGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACA
GTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAG
GGGATCCCATCCCTAAGAGCCCTTTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.