Search our product database

Search options:
Product name: hCREBZF €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-16029-1
Sigma Product ID: EHU160291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137504
Ensembl Transcript ID: ENST00000260058, ENST00000490820, ENST00000525639, ENST00000527447
Gene coordinates (GRCh38): 11:85659708-85682908
HGNC Alias: ZF
HGNC ID: HGNC:24905
HGNC Symbol: CREBZF
NCBI gene: 58487
RefSeq mRNA: NM_001039618
RefSeq ncRNA: NR_028024, NR_028025, NR_028027
Sequence:AAAAGAGGCGGAGAAAGTCCCCAGGAGGAGGCGGCGGTGGCGGCAGCGGTAACGA
CAACAACCAGGCGGCGACAAAGAGTCCCCGGAAGGCGGCGGCGGCCGCTGCCCGC
CTTAATCGACTGAAGAAGAAGGAGTACGTGATGGGGCTGGAGAGTCGAGTCCGGG
GTCTGGCAGCCGAGAACCAGGAGCTGCGGGCCGAGAATCGGGAGCTGGGCAAACG
CGTACAGGCACTGCAGGAGGAGAGTCGCTACCTACGGGCAGTCTTAGCCAACGAG
ACTGGACTGGCTCGCTTGCTGAGCCGGCTGAGCGGCGTGGGACTGCGGCTGACCA
CCTCGCTCTTCAGAGACTCGCCCGCCGGTGACCACGACTACGCTCTGCCGGTGGG
AAAGCAGAAGCAGGACCTG
Product name: hCREBZF €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-16029-1
Sigma Product ID: EHU160291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137504
Ensembl Transcript ID: ENST00000260058, ENST00000490820, ENST00000525639, ENST00000527447
Gene coordinates (GRCh38): 11:85659708-85682908
HGNC Alias: ZF
HGNC ID: HGNC:24905
HGNC Symbol: CREBZF
NCBI gene: 58487
RefSeq mRNA: NM_001039618
RefSeq ncRNA: NR_028024, NR_028025, NR_028027
Sequence:AAAAGAGGCGGAGAAAGTCCCCAGGAGGAGGCGGCGGTGGCGGCAGCGGTAACGA
CAACAACCAGGCGGCGACAAAGAGTCCCCGGAAGGCGGCGGCGGCCGCTGCCCGC
CTTAATCGACTGAAGAAGAAGGAGTACGTGATGGGGCTGGAGAGTCGAGTCCGGG
GTCTGGCAGCCGAGAACCAGGAGCTGCGGGCCGAGAATCGGGAGCTGGGCAAACG
CGTACAGGCACTGCAGGAGGAGAGTCGCTACCTACGGGCAGTCTTAGCCAACGAG
ACTGGACTGGCTCGCTTGCTGAGCCGGCTGAGCGGCGTGGGACTGCGGCTGACCA
CCTCGCTCTTCAGAGACTCGCCCGCCGGTGACCACGACTACGCTCTGCCGGTGGG
AAAGCAGAAGCAGGACCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.