Search our product database

Search options:
Product name: hCAPN1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03258-1
Sigma Product ID: EHU032581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000014216
Ensembl Transcript ID: ENST00000279247, ENST00000524773, ENST00000527323, ENST00000533129, ENST00000533820
Gene coordinates (GRCh38): 11:65180566-65212006
HGNC Alias: CANP, CANPL1, muCANP, muCL
HGNC ID: HGNC:1476
HGNC Symbol: CAPN1
NCBI gene: 823
RefSeq mRNA: NM_001198868, NM_001198869, NM_005186
RefSeq ncRNA: NR_040008
Sequence:GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCA
AACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGT
GAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATC
CTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACA
AGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTT
CAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGAC
CTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGT
TCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTT
GTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG
Product name: hCAPN1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03258-1
Sigma Product ID: EHU032581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000014216
Ensembl Transcript ID: ENST00000279247, ENST00000524773, ENST00000527323, ENST00000533129, ENST00000533820
Gene coordinates (GRCh38): 11:65180566-65212006
HGNC Alias: CANP, CANPL1, muCANP, muCL
HGNC ID: HGNC:1476
HGNC Symbol: CAPN1
NCBI gene: 823
RefSeq mRNA: NM_001198868, NM_001198869, NM_005186
RefSeq ncRNA: NR_040008
Sequence:GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCA
AACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGT
GAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATC
CTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACA
AGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTT
CAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGAC
CTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGT
TCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTT
GTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.