Search our product database

Search options:
Product name: hFAS €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06023-1
Sigma Product ID: EHU060231
Species: Homo sapiens
Ensembl Gene ID: ENSG00000026103
Ensembl Transcript ID: ENST00000355740, ENST00000612663
Gene coordinates (GRCh38): 10:88990531-89017059
HGNC Alias: APO-1, APT1, CD95, FAS1, TNFRSF6
HGNC ID: HGNC:11920
HGNC Symbol: FAS
NCBI gene: 355
RefSeq mRNA: NM_001320619
Sequence:GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGG
CTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTC
GCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGG
TTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCC
TGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGG
ACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAA
CCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATT
ATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAA
TTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG
Product name: hFAS €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06023-1
Sigma Product ID: EHU060231
Species: Homo sapiens
Ensembl Gene ID: ENSG00000026103
Ensembl Transcript ID: ENST00000355740, ENST00000612663
Gene coordinates (GRCh38): 10:88990531-89017059
HGNC Alias: APO-1, APT1, CD95, FAS1, TNFRSF6
HGNC ID: HGNC:11920
HGNC Symbol: FAS
NCBI gene: 355
RefSeq mRNA: NM_001320619
Sequence:GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGG
CTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTC
GCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGG
TTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCC
TGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGG
ACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAA
CCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATT
ATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAA
TTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.