Search our product database

Search options:
Product name: hPOLD1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13110-1
Sigma Product ID: EHU131101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000062822
Ensembl Transcript ID: ENST00000440232, ENST00000595904, ENST00000599857, ENST00000600859, ENST00000613923, ENST00000643407
Gene coordinates (GRCh38): 19:50384204-50418016
HGNC Alias: CDC2, POLD
HGNC ID: HGNC:9175
HGNC Symbol: POLD1
NCBI gene: 5424
RefSeq mRNA: NM_001256849, NM_001308632, NM_002691
RefSeq ncRNA: NR_046402
Sequence:CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGA
GTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTG
CTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCC
GGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGT
ATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAG
AGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGT
CTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGA
CACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCC
CTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT
Product name: hPOLD1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13110-1
Sigma Product ID: EHU131101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000062822
Ensembl Transcript ID: ENST00000440232, ENST00000595904, ENST00000599857, ENST00000600859, ENST00000613923, ENST00000643407
Gene coordinates (GRCh38): 19:50384204-50418016
HGNC Alias: CDC2, POLD
HGNC ID: HGNC:9175
HGNC Symbol: POLD1
NCBI gene: 5424
RefSeq mRNA: NM_001256849, NM_001308632, NM_002691
RefSeq ncRNA: NR_046402
Sequence:CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGA
GTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTG
CTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCC
GGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGT
ATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAG
AGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGT
CTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGA
CACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCC
CTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.