Search our product database

Search options:
Product name: hRHOA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07737-1
Sigma Product ID: EHU077371
Species: Homo sapiens
Ensembl Gene ID: ENSG00000067560
Ensembl Transcript ID: ENST00000418115, ENST00000422781, ENST00000445425
Gene coordinates (GRCh38): 3:49359145-49412998
HGNC Alias: ARH12, ARHA, Rho12, RhoA, RHOH12
HGNC ID: HGNC:667
HGNC Symbol: RHOA
NCBI gene: 387
RefSeq mRNA: NM_001313941, NM_001313943, NM_001313944, NM_001313945, NM_001664
Sequence:CGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCGCGGACCGG
CGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTGCCA
TCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCT
CATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAG
AACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGG
ACACAGCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATAC
CGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATC
CCAGAAAAGTGGACCCCAGAA
Product name: hRHOA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07737-1
Sigma Product ID: EHU077371
Species: Homo sapiens
Ensembl Gene ID: ENSG00000067560
Ensembl Transcript ID: ENST00000418115, ENST00000422781, ENST00000445425
Gene coordinates (GRCh38): 3:49359145-49412998
HGNC Alias: ARH12, ARHA, Rho12, RhoA, RHOH12
HGNC ID: HGNC:667
HGNC Symbol: RHOA
NCBI gene: 387
RefSeq mRNA: NM_001313941, NM_001313943, NM_001313944, NM_001313945, NM_001664
Sequence:CGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCGCGGACCGG
CGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTGCCA
TCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCT
CATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAG
AACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGG
ACACAGCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATAC
CGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATC
CCAGAAAAGTGGACCCCAGAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.