Search our product database

Search options:
Product name: hHSP90AA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11467-1
Sigma Product ID: EHU114671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000080824
Ensembl Transcript ID: ENST00000216281, ENST00000334701
Gene coordinates (GRCh38): 14:102080738-102139699
HGNC Alias: FLJ31884, Hsp89, Hsp90, HSP90N, HSPC1, HSPCA
HGNC ID: HGNC:5253
HGNC Symbol: HSP90AA1
NCBI gene: 3320
RefSeq mRNA: NM_001017963, NM_005348
Sequence:TGGTGACATCTCCATGCTGTATTGTCACAAGCACATATGGCTGGACAGCAAACAT
GGAGAGAATCATGAAAGCTCAAGCCCTAAGAGACAACTCAACAATGGGTTACATG
GCAGCAAAGAAACACCTGGAGATAAACCCTGACCATTCCATTATTGAGACCTTAA
GGCAAAAGGCAGAGGCTGATAAGAACGACAAGTCTGTGAAGGATCTGGTCATCTT
GCTTTATGAAACTGCGCTCCTGTCTTCTGGCTTCAGTCTGGAAGATCCCCAGACA
CATGCTAACAGGATCTACAGGATGATCAAACTTGGTCTGGGTATTGATGAAGATG
ACCCTACTGCTGATGATACCAGTGCTGCTGTAACTGAAGAAATGCCACCCCTTGA
AGGAGATGACGACACATCACGCATGGAAGAAGTAGACTAATCTCTGGCTGAGGGA
TGACT
Product name: hHSP90AA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11467-1
Sigma Product ID: EHU114671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000080824
Ensembl Transcript ID: ENST00000216281, ENST00000334701
Gene coordinates (GRCh38): 14:102080738-102139699
HGNC Alias: FLJ31884, Hsp89, Hsp90, HSP90N, HSPC1, HSPCA
HGNC ID: HGNC:5253
HGNC Symbol: HSP90AA1
NCBI gene: 3320
RefSeq mRNA: NM_001017963, NM_005348
Sequence:TGGTGACATCTCCATGCTGTATTGTCACAAGCACATATGGCTGGACAGCAAACAT
GGAGAGAATCATGAAAGCTCAAGCCCTAAGAGACAACTCAACAATGGGTTACATG
GCAGCAAAGAAACACCTGGAGATAAACCCTGACCATTCCATTATTGAGACCTTAA
GGCAAAAGGCAGAGGCTGATAAGAACGACAAGTCTGTGAAGGATCTGGTCATCTT
GCTTTATGAAACTGCGCTCCTGTCTTCTGGCTTCAGTCTGGAAGATCCCCAGACA
CATGCTAACAGGATCTACAGGATGATCAAACTTGGTCTGGGTATTGATGAAGATG
ACCCTACTGCTGATGATACCAGTGCTGCTGTAACTGAAGAAATGCCACCCCTTGA
AGGAGATGACGACACATCACGCATGGAAGAAGTAGACTAATCTCTGGCTGAGGGA
TGACT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.