Search our product database

Search options:
Product name: hHIF1A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15198-1
Sigma Product ID: EHU151981
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100644
Ensembl Transcript ID: ENST00000323441, ENST00000337138, ENST00000394997, ENST00000539097, ENST00000557538
Gene coordinates (GRCh38): 14:61695513-61748259
HGNC Alias: bHLHe78, HIF1, HIF-1alpha, MOP1, PASD8
HGNC ID: HGNC:4910
HGNC Symbol: HIF1A
NCBI gene: 3091
RefSeq mRNA: NM_001243084, NM_001530, NM_181054
Sequence:TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAAC
AGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGA
TTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGAC
TTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATT
ACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAAT
ATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTAC
TAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATAT
GTCTGGGTTGAAACTCAAGC
Product name: hHIF1A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15198-1
Sigma Product ID: EHU151981
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100644
Ensembl Transcript ID: ENST00000323441, ENST00000337138, ENST00000394997, ENST00000539097, ENST00000557538
Gene coordinates (GRCh38): 14:61695513-61748259
HGNC Alias: bHLHe78, HIF1, HIF-1alpha, MOP1, PASD8
HGNC ID: HGNC:4910
HGNC Symbol: HIF1A
NCBI gene: 3091
RefSeq mRNA: NM_001243084, NM_001530, NM_181054
Sequence:TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAAC
AGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGA
TTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGAC
TTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATT
ACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAAT
ATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTAC
TAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATAT
GTCTGGGTTGAAACTCAAGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.