Search our product database

Search options:
Product name: hNFKBIA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04372-1
Sigma Product ID: EHU043721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100906
Ensembl Transcript ID: ENST00000216797, ENST00000554001, ENST00000555371, ENST00000557389
Gene coordinates (GRCh38): 14:35401511-35404749
HGNC Alias: IkappaBalpha, IKBA, MAD-3, NFKBI
HGNC ID: HGNC:7797
HGNC Symbol: NFKBIA
NCBI gene: 4792
RefSeq mRNA: NM_020529
Sequence:CCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCTACACTTAGCC
TCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATG
TCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCT
GCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGA
GTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAAGCACCC
GGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTGCCAGA
GAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAG
GACGAGCTGCCCTATGATGAC
Product name: hNFKBIA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04372-1
Sigma Product ID: EHU043721
Species: Homo sapiens
Ensembl Gene ID: ENSG00000100906
Ensembl Transcript ID: ENST00000216797, ENST00000554001, ENST00000555371, ENST00000557389
Gene coordinates (GRCh38): 14:35401511-35404749
HGNC Alias: IkappaBalpha, IKBA, MAD-3, NFKBI
HGNC ID: HGNC:7797
HGNC Symbol: NFKBIA
NCBI gene: 4792
RefSeq mRNA: NM_020529
Sequence:CCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCTACACTTAGCC
TCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATG
TCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCT
GCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGA
GTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAAGCACCC
GGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTGCCAGA
GAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAG
GACGAGCTGCCCTATGATGAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.