Search our product database

Search options:
Product name: hMAPK3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06248-1
Sigma Product ID: EHU062481
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102882
Ensembl Transcript ID: ENST00000263025, ENST00000322266, ENST00000395199, ENST00000395202, ENST00000466521, ENST00000484663, ENST00000490298
Gene coordinates (GRCh38): 16:30114105-30123506
HGNC Alias: ERK1, p44erk1, p44mapk, PRKM3
HGNC ID: HGNC:6877
HGNC Symbol: MAPK3
NCBI gene: 5595
RefSeq mRNA: NM_001040056, NM_001109891, NM_002746
Sequence:CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTG
TACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCT
ACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGA
TCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGAT
TTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGG
AGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGG
CTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTC
TCTAACCGGCCCATCTTCCCTGGCAAGCACTA
Product name: hMAPK3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06248-1
Sigma Product ID: EHU062481
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102882
Ensembl Transcript ID: ENST00000263025, ENST00000322266, ENST00000395199, ENST00000395202, ENST00000466521, ENST00000484663, ENST00000490298
Gene coordinates (GRCh38): 16:30114105-30123506
HGNC Alias: ERK1, p44erk1, p44mapk, PRKM3
HGNC ID: HGNC:6877
HGNC Symbol: MAPK3
NCBI gene: 5595
RefSeq mRNA: NM_001040056, NM_001109891, NM_002746
Sequence:CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTG
TACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCT
ACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGA
TCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGAT
TTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGG
AGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGG
CTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTC
TCTAACCGGCCCATCTTCCCTGGCAAGCACTA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.