Search our product database

Search options:
Product name: hMAPK8 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07297-1
Sigma Product ID: EHU072971
Species: Homo sapiens
Ensembl Gene ID: ENSG00000107643
Ensembl Transcript ID: ENST00000360332, ENST00000374174, ENST00000374176, ENST00000374179, ENST00000374182, ENST00000374189, ENST00000395611
Gene coordinates (GRCh38): 10:48306639-48439360
HGNC Alias: JNK, JNK1, PRKM8, SAPK1
HGNC ID: HGNC:6881
HGNC Symbol: MAPK8
NCBI gene: 5599
RefSeq mRNA: NM_001278547, NM_001278548, NM_001323302, NM_001323320, NM_001323321, NM_001323322, NM_001323323, NM_001323324, NM_001323325, NM_001323326, NM_001323327, NM_001323328, NM_001323329, NM_001323330, NM_001323331, NM_139046, NM_139049
RefSeq ncRNA: NR_136583, NR_136584, NR_136585
Sequence:AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGC
TAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTT
CACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTC
ATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGT
CCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAAT
TATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTG
AAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGC
CTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTA
CAAGGAAAAC
Product name: hMAPK8 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07297-1
Sigma Product ID: EHU072971
Species: Homo sapiens
Ensembl Gene ID: ENSG00000107643
Ensembl Transcript ID: ENST00000360332, ENST00000374174, ENST00000374176, ENST00000374179, ENST00000374182, ENST00000374189, ENST00000395611
Gene coordinates (GRCh38): 10:48306639-48439360
HGNC Alias: JNK, JNK1, PRKM8, SAPK1
HGNC ID: HGNC:6881
HGNC Symbol: MAPK8
NCBI gene: 5599
RefSeq mRNA: NM_001278547, NM_001278548, NM_001323302, NM_001323320, NM_001323321, NM_001323322, NM_001323323, NM_001323324, NM_001323325, NM_001323326, NM_001323327, NM_001323328, NM_001323329, NM_001323330, NM_001323331, NM_139046, NM_139049
RefSeq ncRNA: NR_136583, NR_136584, NR_136585
Sequence:AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGC
TAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTT
CACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTC
ATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGT
CCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAAT
TATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTG
AAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGC
CTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTA
CAAGGAAAAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.