Search our product database

Search options:
Product name: hCCND1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15332-1
Sigma Product ID: EHU153321
Species: Homo sapiens
Ensembl Gene ID: ENSG00000110092
Ensembl Transcript ID: ENST00000227507
Gene coordinates (GRCh38): 11:69641087-69654474
HGNC Alias: BCL1, D11S287E, PRAD1, U21B31
HGNC ID: HGNC:1582
HGNC Symbol: CCND1
NCBI gene: 595
RefSeq mRNA: NM_053056
Sequence:AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGC
TGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCT
GACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTG
CTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGA
CCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAA
CAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGAT
GTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCG
CAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCT
CA
Product name: hCCND1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15332-1
Sigma Product ID: EHU153321
Species: Homo sapiens
Ensembl Gene ID: ENSG00000110092
Ensembl Transcript ID: ENST00000227507
Gene coordinates (GRCh38): 11:69641087-69654474
HGNC Alias: BCL1, D11S287E, PRAD1, U21B31
HGNC ID: HGNC:1582
HGNC Symbol: CCND1
NCBI gene: 595
RefSeq mRNA: NM_053056
Sequence:AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGC
TGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCT
GACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTG
CTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGA
CCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAA
CAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGAT
GTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCG
CAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCT
CA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.