Search our product database

Search options:
Product name: hRND3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00969-1
Sigma Product ID: EHU009691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115963
Ensembl Transcript ID: ENST00000263895, ENST00000375734, ENST00000409557, ENST00000497865
Gene coordinates (GRCh38): 2:150468195-150539011
HGNC Alias: ARHE, Rho8, RhoE
HGNC ID: HGNC:671
HGNC Symbol: RND3
NCBI gene: 390
RefSeq mRNA: NM_001254738, NM_005168
Sequence:GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCA
ATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGAT
TGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGA
GACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTA
AGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACC
AGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACT
GTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAA
CAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC
Product name: hRND3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00969-1
Sigma Product ID: EHU009691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115963
Ensembl Transcript ID: ENST00000263895, ENST00000375734, ENST00000409557, ENST00000497865
Gene coordinates (GRCh38): 2:150468195-150539011
HGNC Alias: ARHE, Rho8, RhoE
HGNC ID: HGNC:671
HGNC Symbol: RND3
NCBI gene: 390
RefSeq mRNA: NM_001254738, NM_005168
Sequence:GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCA
ATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGAT
TGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGA
GACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTA
AGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACC
AGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACT
GTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAA
CAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.