Search our product database

Search options:
Product name: hHDAC1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02584-1
Sigma Product ID: EHU025841
Species: Homo sapiens
Ensembl Gene ID: ENSG00000116478
Ensembl Transcript ID: ENST00000373548, ENST00000463172, ENST00000481281
Gene coordinates (GRCh38): 1:32292086-32333635
HGNC Alias: GON-10, HD1, RPD3L1
HGNC ID: HGNC:4852
HGNC Symbol: HDAC1
NCBI gene: 3065
RefSeq mRNA: NM_004964
Sequence:CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGG
AAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGA
TGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGC
AAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGT
TTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAA
TAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAG
AAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGG
AACTGCTAAAGTATCACCAGAGGGTGCTGTACA
Product name: hHDAC1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-02584-1
Sigma Product ID: EHU025841
Species: Homo sapiens
Ensembl Gene ID: ENSG00000116478
Ensembl Transcript ID: ENST00000373548, ENST00000463172, ENST00000481281
Gene coordinates (GRCh38): 1:32292086-32333635
HGNC Alias: GON-10, HD1, RPD3L1
HGNC ID: HGNC:4852
HGNC Symbol: HDAC1
NCBI gene: 3065
RefSeq mRNA: NM_004964
Sequence:CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGG
AAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGA
TGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGC
AAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGT
TTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAA
TAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAG
AAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGG
AACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.