Search our product database

Search options:
Product name: hKDR €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15561-1
Sigma Product ID: EHU155611
Species: Homo sapiens
Ensembl Gene ID: ENSG00000128052
Ensembl Transcript ID: ENST00000263923, ENST00000512566, ENST00000645273, ENST00000647068
Gene coordinates (GRCh38): 4:55078259-55125595
HGNC Alias: CD309, FLK1, VEGFR, VEGFR2
HGNC ID: HGNC:6307
HGNC Symbol: KDR
NCBI gene: 3791
RefSeq mRNA: NM_002253
Sequence:AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACA
CTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGT
CTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGA
GTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGT
CCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGT
TCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGC
TACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAA
GTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGT
GGTTCTGAGTCCGTCTCATGGAA
Product name: hKDR €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-15561-1
Sigma Product ID: EHU155611
Species: Homo sapiens
Ensembl Gene ID: ENSG00000128052
Ensembl Transcript ID: ENST00000263923, ENST00000512566, ENST00000645273, ENST00000647068
Gene coordinates (GRCh38): 4:55078259-55125595
HGNC Alias: CD309, FLK1, VEGFR, VEGFR2
HGNC ID: HGNC:6307
HGNC Symbol: KDR
NCBI gene: 3791
RefSeq mRNA: NM_002253
Sequence:AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACA
CTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGT
CTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGA
GTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGT
CCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGT
TCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGC
TACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAA
GTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGT
GGTTCTGAGTCCGTCTCATGGAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.