Search our product database

Search options:
Product name: hCASP9 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07360-1
Sigma Product ID: EHU073601
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132906
Ensembl Transcript ID: ENST00000333868, ENST00000348549, ENST00000400777, ENST00000546424
Gene coordinates (GRCh38): 1:15490832-15526534
HGNC Alias: APAF-3, ICE-LAP6, MCH6, PPP1R56
HGNC ID: HGNC:1511
HGNC Symbol: CASP9
NCBI gene: 842
RefSeq mRNA: NM_001229, NM_001278054
RefSeq ncRNA: NR_102732, NR_102733
Sequence:TCCAGATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAATGCCGT
GGATTGCACGTGGCCTCTTGAGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTCC
CATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAACCTCTGCACTACTGACATGT
GGGGCCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGTTCAGC
ACTGTCCCTTGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAA
AGGTTCTCAGGTGTTGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGAC
AACCACTGGTCTGTAGGGATTTTTGGCTACACACAAACCAGTATCGCTCATAGAT
CAGCAAACCGGGGCCTACTAGAGT
Product name: hCASP9 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07360-1
Sigma Product ID: EHU073601
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132906
Ensembl Transcript ID: ENST00000333868, ENST00000348549, ENST00000400777, ENST00000546424
Gene coordinates (GRCh38): 1:15490832-15526534
HGNC Alias: APAF-3, ICE-LAP6, MCH6, PPP1R56
HGNC ID: HGNC:1511
HGNC Symbol: CASP9
NCBI gene: 842
RefSeq mRNA: NM_001229, NM_001278054
RefSeq ncRNA: NR_102732, NR_102733
Sequence:TCCAGATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAATGCCGT
GGATTGCACGTGGCCTCTTGAGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTCC
CATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAACCTCTGCACTACTGACATGT
GGGGCCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGTTCAGC
ACTGTCCCTTGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAA
AGGTTCTCAGGTGTTGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGAC
AACCACTGGTCTGTAGGGATTTTTGGCTACACACAAACCAGTATCGCTCATAGAT
CAGCAAACCGGGGCCTACTAGAGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.