Search our product database

Search options:
Product name: hKRAS €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11443-1
Sigma Product ID: EHU114431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000133703
Ensembl Transcript ID: ENST00000256078, ENST00000311936
Gene coordinates (GRCh38): 12:25204789-25250936
HGNC Alias: KRAS1, KRAS2
HGNC ID: HGNC:6407
HGNC Symbol: KRAS
NCBI gene: 3845
RefSeq mRNA: NM_004985, NM_033360
Sequence:AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTA
GGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATG
ATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTG
TCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGAC
CAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTA
AATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTC
TGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACA
GTAGACACAAAACAGGCTCAGGA
Product name: hKRAS €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-11443-1
Sigma Product ID: EHU114431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000133703
Ensembl Transcript ID: ENST00000256078, ENST00000311936
Gene coordinates (GRCh38): 12:25204789-25250936
HGNC Alias: KRAS1, KRAS2
HGNC ID: HGNC:6407
HGNC Symbol: KRAS
NCBI gene: 3845
RefSeq mRNA: NM_004985, NM_033360
Sequence:AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTA
GGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATG
ATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTG
TCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGAC
CAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTA
AATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTC
TGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACA
GTAGACACAAAACAGGCTCAGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.