Search our product database

Search options:
Product name: hMYCN (1) €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09356-1
Sigma Product ID: EHU093561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134323
Ensembl Transcript ID: ENST00000281043, ENST00000638417
Gene coordinates (GRCh38): 2:15940564-15947007
HGNC Alias: bHLHe37, MYCNOT, N-myc, NMYC
HGNC ID: HGNC:7559
HGNC Symbol: MYCN
NCBI gene: 4613
RefSeq mRNA: NM_001293228, NM_001293231, NM_001293233, NM_005378
Sequence:GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCA
CATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCC
AGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCG
CCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAG
CGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTG
AGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCC
TGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC
Product name: hMYCN (1) €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-09356-1
Sigma Product ID: EHU093561
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134323
Ensembl Transcript ID: ENST00000281043, ENST00000638417
Gene coordinates (GRCh38): 2:15940564-15947007
HGNC Alias: bHLHe37, MYCNOT, N-myc, NMYC
HGNC ID: HGNC:7559
HGNC Symbol: MYCN
NCBI gene: 4613
RefSeq mRNA: NM_001293228, NM_001293231, NM_001293233, NM_005378
Sequence:GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCA
CATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCC
AGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCG
CCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAG
CGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTG
AGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCC
TGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC
Product name: hMYCN (2) €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10055-1
Sigma Product ID: EHU100551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134323
Ensembl Transcript ID: ENST00000281043, ENST00000638417
Gene coordinates (GRCh38): 2:15940564-15947007
HGNC Alias: bHLHe37, MYCNOT, N-myc, NMYC
HGNC ID: HGNC:7559
HGNC Symbol: MYCN
NCBI gene: 4613
RefSeq mRNA: NM_001293228, NM_001293231, NM_001293233, NM_005378
Sequence:TCAATGTTTGAGGAGCATGTTTTGTATACAAATATATTGTTAATCTCTGTTATGT
ACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGACGCTGATACATAACT
AAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGAT
ATTACTTTATCACTTTTTGAACTAAGAAACTTTTGTAAAGAAATTTACTATATAT
ATATGCCTTTTTCCTAGCCTGTTTCTTCCTGTTAATGTATTTGTTCATGTTTGGT
GCATAGAACTGGGTAAATGCAAAGTTCTGTGTT
Product name: hMYCN (2) €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-10055-1
Sigma Product ID: EHU100551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134323
Ensembl Transcript ID: ENST00000281043, ENST00000638417
Gene coordinates (GRCh38): 2:15940564-15947007
HGNC Alias: bHLHe37, MYCNOT, N-myc, NMYC
HGNC ID: HGNC:7559
HGNC Symbol: MYCN
NCBI gene: 4613
RefSeq mRNA: NM_001293228, NM_001293231, NM_001293233, NM_005378
Sequence:TCAATGTTTGAGGAGCATGTTTTGTATACAAATATATTGTTAATCTCTGTTATGT
ACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGACGCTGATACATAACT
AAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGAT
ATTACTTTATCACTTTTTGAACTAAGAAACTTTTGTAAAGAAATTTACTATATAT
ATATGCCTTTTTCCTAGCCTGTTTCTTCCTGTTAATGTATTTGTTCATGTTTGGT
GCATAGAACTGGGTAAATGCAAAGTTCTGTGTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.