Search our product database

Search options:
Product name: hIQGAP1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13792-1
Sigma Product ID: EHU137921
Species: Homo sapiens
Ensembl Gene ID: ENSG00000140575
Ensembl Transcript ID: ENST00000268182, ENST00000558957, ENST00000561086, ENST00000633485
Gene coordinates (GRCh38): 15:90388218-90502243
HGNC Alias: HUMORFA01, KIAA0051, p195, SAR1
HGNC ID: HGNC:6110
HGNC Symbol: IQGAP1
NCBI gene: 8826
RefSeq mRNA: NM_003870
Sequence:AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTG
CTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAG
TAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATT
GATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTT
TCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCA
ATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATT
TGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGG
TTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCT
CTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTG
TTTAATTAGCAATAGGGATGGTAGGATTCA
Product name: hIQGAP1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13792-1
Sigma Product ID: EHU137921
Species: Homo sapiens
Ensembl Gene ID: ENSG00000140575
Ensembl Transcript ID: ENST00000268182, ENST00000558957, ENST00000561086, ENST00000633485
Gene coordinates (GRCh38): 15:90388218-90502243
HGNC Alias: HUMORFA01, KIAA0051, p195, SAR1
HGNC ID: HGNC:6110
HGNC Symbol: IQGAP1
NCBI gene: 8826
RefSeq mRNA: NM_003870
Sequence:AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTG
CTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAG
TAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATT
GATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTT
TCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCA
ATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATT
TGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGG
TTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCT
CTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTG
TTTAATTAGCAATAGGGATGGTAGGATTCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.