Search our product database

Search options:
Product name: hTP53 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12322-1
Sigma Product ID: EHU123221
Species: Homo sapiens
Ensembl Gene ID: ENSG00000141510
Ensembl Transcript ID: ENST00000269305, ENST00000359597, ENST00000420246, ENST00000445888, ENST00000455263, ENST00000504290, ENST00000504937, ENST00000509690, ENST00000510385, ENST00000610292, ENST00000610538, ENST00000610623, ENST00000615910, ENST00000617185, ENST00000618944, ENST00000619186, ENST00000619485, ENST00000620739, ENST00000622645, ENST00000635293
Gene coordinates (GRCh38): 17:7661779-7687550
HGNC Alias: LFS1, p53
HGNC ID: HGNC:11998
HGNC Symbol: TP53
NCBI gene: 7157
RefSeq mRNA: NM_000546, NM_001126112, NM_001126113, NM_001126114, NM_001126115, NM_001126116, NM_001126117, NM_001126118, NM_001276695, NM_001276696, NM_001276697, NM_001276698, NM_001276699, NM_001276760, NM_001276761
Sequence:CATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAG
TGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAG
TGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCAC
TACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCC
TCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTT
TGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAAT
CTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAG
CACTGCCCAACAACACCAGCTCCTCT
Product name: hTP53 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-12322-1
Sigma Product ID: EHU123221
Species: Homo sapiens
Ensembl Gene ID: ENSG00000141510
Ensembl Transcript ID: ENST00000269305, ENST00000359597, ENST00000420246, ENST00000445888, ENST00000455263, ENST00000504290, ENST00000504937, ENST00000509690, ENST00000510385, ENST00000610292, ENST00000610538, ENST00000610623, ENST00000615910, ENST00000617185, ENST00000618944, ENST00000619186, ENST00000619485, ENST00000620739, ENST00000622645, ENST00000635293
Gene coordinates (GRCh38): 17:7661779-7687550
HGNC Alias: LFS1, p53
HGNC ID: HGNC:11998
HGNC Symbol: TP53
NCBI gene: 7157
RefSeq mRNA: NM_000546, NM_001126112, NM_001126113, NM_001126114, NM_001126115, NM_001126116, NM_001126117, NM_001126118, NM_001276695, NM_001276696, NM_001276697, NM_001276698, NM_001276699, NM_001276760, NM_001276761
Sequence:CATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAG
TGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAG
TGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCAC
TACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCC
TCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTT
TGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAAT
CTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAG
CACTGCCCAACAACACCAGCTCCTCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.