Search our product database

Search options:
Product name: hAKT1,RP11-982M15.2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08350-1
Sigma Product ID: EHU083501
Species: Homo sapiens
Ensembl Gene ID: ENSG00000142208
Ensembl Transcript ID: ENST00000349310, ENST00000402615, ENST00000407796, ENST00000553506, ENST00000554581, ENST00000555528, ENST00000557552, ENST00000610370, ENST00000649815
Gene coordinates (GRCh38): 14:104769349-104795751
HGNC Alias: AKT, PKB, PRKBA, RAC
HGNC ID: HGNC:391
HGNC Symbol: AKT1
NCBI gene: 207
RefSeq mRNA: NM_001014431, NM_001014432, NM_005163
Sequence:ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTG
GCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGC
CGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTC
AGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCC
TCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTG
AGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCC
AGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTAT
GTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC
Product name: hAKT1,RP11-982M15.2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08350-1
Sigma Product ID: EHU083501
Species: Homo sapiens
Ensembl Gene ID: ENSG00000142208
Ensembl Transcript ID: ENST00000349310, ENST00000402615, ENST00000407796, ENST00000553506, ENST00000554581, ENST00000555528, ENST00000557552, ENST00000610370, ENST00000649815
Gene coordinates (GRCh38): 14:104769349-104795751
HGNC Alias: AKT, PKB, PRKBA, RAC
HGNC ID: HGNC:391
HGNC Symbol: AKT1
NCBI gene: 207
RefSeq mRNA: NM_001014431, NM_001014432, NM_005163
Sequence:ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTG
GCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGC
CGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTC
AGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCC
TCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTG
AGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCC
AGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTAT
GTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.