Search our product database

Search options:
Product name: hHMBOX1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08851-1
Sigma Product ID: EHU088511
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147421
Ensembl Transcript ID: ENST00000287701, ENST00000355231, ENST00000397358, ENST00000519047, ENST00000521516, ENST00000523613, ENST00000524238, ENST00000558662, ENST00000560599
Gene coordinates (GRCh38): 8:28890394-29064764
HGNC Alias: FLJ21616, HNF1LA, HOT1, PBHNF
HGNC ID: HGNC:26137
HGNC Symbol: HMBOX1
NCBI gene: 79618
RefSeq mRNA: NM_001135726, NM_001324382, NM_001324383, NM_001324384, NM_001324385, NM_001324386, NM_001324387, NM_001324388, NM_001324389, NM_001324390, NM_001324391, NM_001324392, NM_001324393, NM_001324394, NM_001324395, NM_001330498, NM_024567
RefSeq ncRNA: NR_136757, NR_136758
Sequence:ATTTCCCAAGCAGTTGTTGCACAGGTAACAGGTATCAGTCAGAGCCGGATCTCTC
ATTGGCTGTTGCAGCAGGGATCAGACCTGAGTGAACAGAAGAAAAGAGCATTTTA
CCGATGGTATCAACTTGAGAAGACAAACCCTGGCGCTACACTAAGTATGAGACCA
GCCCCCATTCCAATAGAGGACCCTGAATGGAGACAAACGCCTCCCCCAGTCTCTG
CCACATCTGGTACTTTCCGACTGCGACGAGGGAGTCGATTTACCTGGAGAAAGGA
GTGCCTGGCTGTTATGGAAAGTTACTTCAATGAGAATCAATACCCAGATGAAGCA
AAGAGGGAAGAAATTGCAAACGCTTGCAATGCAGTTATACAGAAGCCAGGCAAAA
AGCTGTCAGATCTGG
Product name: hHMBOX1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08851-1
Sigma Product ID: EHU088511
Species: Homo sapiens
Ensembl Gene ID: ENSG00000147421
Ensembl Transcript ID: ENST00000287701, ENST00000355231, ENST00000397358, ENST00000519047, ENST00000521516, ENST00000523613, ENST00000524238, ENST00000558662, ENST00000560599
Gene coordinates (GRCh38): 8:28890394-29064764
HGNC Alias: FLJ21616, HNF1LA, HOT1, PBHNF
HGNC ID: HGNC:26137
HGNC Symbol: HMBOX1
NCBI gene: 79618
RefSeq mRNA: NM_001135726, NM_001324382, NM_001324383, NM_001324384, NM_001324385, NM_001324386, NM_001324387, NM_001324388, NM_001324389, NM_001324390, NM_001324391, NM_001324392, NM_001324393, NM_001324394, NM_001324395, NM_001330498, NM_024567
RefSeq ncRNA: NR_136757, NR_136758
Sequence:ATTTCCCAAGCAGTTGTTGCACAGGTAACAGGTATCAGTCAGAGCCGGATCTCTC
ATTGGCTGTTGCAGCAGGGATCAGACCTGAGTGAACAGAAGAAAAGAGCATTTTA
CCGATGGTATCAACTTGAGAAGACAAACCCTGGCGCTACACTAAGTATGAGACCA
GCCCCCATTCCAATAGAGGACCCTGAATGGAGACAAACGCCTCCCCCAGTCTCTG
CCACATCTGGTACTTTCCGACTGCGACGAGGGAGTCGATTTACCTGGAGAAAGGA
GTGCCTGGCTGTTATGGAAAGTTACTTCAATGAGAATCAATACCCAGATGAAGCA
AAGAGGGAAGAAATTGCAAACGCTTGCAATGCAGTTATACAGAAGCCAGGCAAAA
AGCTGTCAGATCTGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.