Search our product database

Search options:
Product name: hATM €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08952-1
Sigma Product ID: EHU089521
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149311
Ensembl Transcript ID: ENST00000278616, ENST00000452508, ENST00000524792, ENST00000531525, ENST00000533733
Gene coordinates (GRCh38): 11:108222484-108369102
HGNC Alias: ATA, ATC, ATD, ATDC, TEL1, TELO1
HGNC ID: HGNC:795
HGNC Symbol: ATM
NCBI gene: 472
RefSeq mRNA: NM_000051, NM_001351834
Sequence:GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGAC
TTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGA
TTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCAT
TTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATA
TGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAA
TATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGG
AGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAAC
CAAAGGCCTTCTTGT
Product name: hATM €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08952-1
Sigma Product ID: EHU089521
Species: Homo sapiens
Ensembl Gene ID: ENSG00000149311
Ensembl Transcript ID: ENST00000278616, ENST00000452508, ENST00000524792, ENST00000531525, ENST00000533733
Gene coordinates (GRCh38): 11:108222484-108369102
HGNC Alias: ATA, ATC, ATD, ATDC, TEL1, TELO1
HGNC ID: HGNC:795
HGNC Symbol: ATM
NCBI gene: 472
RefSeq mRNA: NM_000051, NM_001351834
Sequence:GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGAC
TTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGA
TTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCAT
TTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATA
TGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAA
TATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGG
AGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAAC
CAAAGGCCTTCTTGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.