Search our product database

Search options:
Product name: hTNFRSF11B €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00524-1
Sigma Product ID: EHU005241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164761
Ensembl Transcript ID: ENST00000297350, ENST00000521597
Gene coordinates (GRCh38): 8:118923557-118952200
HGNC Alias: OCIF, OPG, TR1
HGNC ID: HGNC:11909
HGNC Symbol: TNFRSF11B
NCBI gene: 4982
RefSeq mRNA: NM_002546
Sequence:AGGAAATGCAACACACGACAACATATGTTCCGGAAACAGTGAATCAACTCAAAAA
TGTGGAATAGATGTTACCCTGTGTGAGGAGGCATTCTTCAGGTTTGCTGTTCCTA
CAAAGTTTACGCCTAACTGGCTTAGTGTCTTGGTAGACAATTTGCCTGGCACCAA
AGTAAACGCAGAGAGTGTAGAGAGGATAAAACGGCAACACAGCTCACAAGAACAG
ACTTTCCAGCTGCTGAAGTTATGGAAACATCAAAACAAAGACCAAGATATAGTCA
AGAAGATCATCCAAGATATTGACCTCTGTGAAAACAGCGTGCAGCGGCACATTGG
ACATGCTAACCTCACCTTCGAGCAGCTTCGTAGCTTGATGGAAAGCTTACCGGGA
AAGAAAGTGGGAGCAGAAGACATTGAAAAAACAATAAAGGCATGCAAACCCAG
Product name: hTNFRSF11B €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-00524-1
Sigma Product ID: EHU005241
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164761
Ensembl Transcript ID: ENST00000297350, ENST00000521597
Gene coordinates (GRCh38): 8:118923557-118952200
HGNC Alias: OCIF, OPG, TR1
HGNC ID: HGNC:11909
HGNC Symbol: TNFRSF11B
NCBI gene: 4982
RefSeq mRNA: NM_002546
Sequence:AGGAAATGCAACACACGACAACATATGTTCCGGAAACAGTGAATCAACTCAAAAA
TGTGGAATAGATGTTACCCTGTGTGAGGAGGCATTCTTCAGGTTTGCTGTTCCTA
CAAAGTTTACGCCTAACTGGCTTAGTGTCTTGGTAGACAATTTGCCTGGCACCAA
AGTAAACGCAGAGAGTGTAGAGAGGATAAAACGGCAACACAGCTCACAAGAACAG
ACTTTCCAGCTGCTGAAGTTATGGAAACATCAAAACAAAGACCAAGATATAGTCA
AGAAGATCATCCAAGATATTGACCTCTGTGAAAACAGCGTGCAGCGGCACATTGG
ACATGCTAACCTCACCTTCGAGCAGCTTCGTAGCTTGATGGAAAGCTTACCGGGA
AAGAAAGTGGGAGCAGAAGACATTGAAAAAACAATAAAGGCATGCAAACCCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.