Search our product database

Search options:
Product name: hILK €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14327-1
Sigma Product ID: EHU143271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166333
Ensembl Transcript ID: ENST00000299421, ENST00000396751, ENST00000420936, ENST00000526711, ENST00000528995, ENST00000530016, ENST00000532063, ENST00000537806
Gene coordinates (GRCh38): 11:6603708-6610874
HGNC ID: HGNC:6040
HGNC Symbol: ILK
NCBI gene: 3611
RefSeq mRNA: NM_001014794, NM_001014795, NM_001278441, NM_001278442, NM_004517
Sequence:ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCA
ATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGG
CATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGC
CGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCA
AGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGA
AGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGT
TTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCT
CCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG
Product name: hILK €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-14327-1
Sigma Product ID: EHU143271
Species: Homo sapiens
Ensembl Gene ID: ENSG00000166333
Ensembl Transcript ID: ENST00000299421, ENST00000396751, ENST00000420936, ENST00000526711, ENST00000528995, ENST00000530016, ENST00000532063, ENST00000537806
Gene coordinates (GRCh38): 11:6603708-6610874
HGNC ID: HGNC:6040
HGNC Symbol: ILK
NCBI gene: 3611
RefSeq mRNA: NM_001014794, NM_001014795, NM_001278441, NM_001278442, NM_004517
Sequence:ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCA
ATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGG
CATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGC
CGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCA
AGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGA
AGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGT
TTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCT
CCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.