Search our product database

Search options:
Product name: hCTNNB1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13942-1
Sigma Product ID: EHU139421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168036
Ensembl Transcript ID: ENST00000349496, ENST00000396183, ENST00000396185, ENST00000405570, ENST00000431914, ENST00000433400, ENST00000441708, ENST00000450969, ENST00000453024, ENST00000642248, ENST00000642315, ENST00000642426, ENST00000642836, ENST00000642886, ENST00000642986, ENST00000642992, ENST00000643031, ENST00000643052, ENST00000643297, ENST00000643541, ENST00000643865, ENST00000643977, ENST00000643992, ENST00000644138, ENST00000644524, ENST00000644678, ENST00000644867, ENST00000644873, ENST00000645210, ENST00000645276, ENST00000645305, ENST00000645320, ENST00000645493, ENST00000645763, ENST00000645900, ENST00000645927, ENST00000645982, ENST00000646074, ENST00000646116, ENST00000646174, ENST00000646369, ENST00000646381, ENST00000646725, ENST00000647021, ENST00000647264, ENST00000647390, ENST00000647413
Gene coordinates (GRCh38): 3:41194741-41260096
HGNC Alias: armadillo, beta-catenin, CTNNB
HGNC ID: HGNC:2514
HGNC Symbol: CTNNB1
NCBI gene: 1499
RefSeq mRNA: NM_001098209, NM_001098210, NM_001330729, NM_001904
Sequence:GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGAT
CCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATG
CTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCT
GGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTC
ACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGG
CTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGC
CATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAG
AATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCAC
CATCCCACT
Product name: hCTNNB1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-13942-1
Sigma Product ID: EHU139421
Species: Homo sapiens
Ensembl Gene ID: ENSG00000168036
Ensembl Transcript ID: ENST00000349496, ENST00000396183, ENST00000396185, ENST00000405570, ENST00000431914, ENST00000433400, ENST00000441708, ENST00000450969, ENST00000453024, ENST00000642248, ENST00000642315, ENST00000642426, ENST00000642836, ENST00000642886, ENST00000642986, ENST00000642992, ENST00000643031, ENST00000643052, ENST00000643297, ENST00000643541, ENST00000643865, ENST00000643977, ENST00000643992, ENST00000644138, ENST00000644524, ENST00000644678, ENST00000644867, ENST00000644873, ENST00000645210, ENST00000645276, ENST00000645305, ENST00000645320, ENST00000645493, ENST00000645763, ENST00000645900, ENST00000645927, ENST00000645982, ENST00000646074, ENST00000646116, ENST00000646174, ENST00000646369, ENST00000646381, ENST00000646725, ENST00000647021, ENST00000647264, ENST00000647390, ENST00000647413
Gene coordinates (GRCh38): 3:41194741-41260096
HGNC Alias: armadillo, beta-catenin, CTNNB
HGNC ID: HGNC:2514
HGNC Symbol: CTNNB1
NCBI gene: 1499
RefSeq mRNA: NM_001098209, NM_001098210, NM_001330729, NM_001904
Sequence:GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGAT
CCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATG
CTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCT
GGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTC
ACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGG
CTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGC
CATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAG
AATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCAC
CATCCCACT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.