Search our product database

Search options:
Product name: hPCSK1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03366-1
Sigma Product ID: EHU033661
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175426
Ensembl Transcript ID: ENST00000311106, ENST00000508626
Gene coordinates (GRCh38): 5:96390415-96434143
HGNC Alias: NEC1, PC1, PC3, SPC3
HGNC ID: HGNC:8743
HGNC Symbol: PCSK1
NCBI gene: 5122
RefSeq mRNA: NM_000439, NM_001177875
Sequence:TGCAAGATACCAGGATGACGGCAGCCCTGCCCAAGCTGGACCTTCATGTGATACC
TGTTTGGCAAAAAGGCATTACGGGCAAAGGAGTTGTTATCACCGTACTGGATGAT
GGTTTGGAGTGGAATCACACGGACATTTATGCCAACTATGATCCAGAGGCTAGCT
ATGATTTTAATGATAATGACCATGATCCATTTCCCCGATATGATCCCACAAACGA
GAACAAACACGGGACCAGATGTGCAGGAGAAATTGCCATGCAAGCAAATAATCAC
AAATGCGGGGTTGGAGTTGCATACAATTCCAAAGTTGGAGGCATAAGAATGCTGG
ATGGCATTGTGACGGATGCTATTGAGGCCAGTTCAATTGGATTCAATCCTGGACA
CGTGGATATTTACAGTGCAAGCTGGGG
Product name: hPCSK1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03366-1
Sigma Product ID: EHU033661
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175426
Ensembl Transcript ID: ENST00000311106, ENST00000508626
Gene coordinates (GRCh38): 5:96390415-96434143
HGNC Alias: NEC1, PC1, PC3, SPC3
HGNC ID: HGNC:8743
HGNC Symbol: PCSK1
NCBI gene: 5122
RefSeq mRNA: NM_000439, NM_001177875
Sequence:TGCAAGATACCAGGATGACGGCAGCCCTGCCCAAGCTGGACCTTCATGTGATACC
TGTTTGGCAAAAAGGCATTACGGGCAAAGGAGTTGTTATCACCGTACTGGATGAT
GGTTTGGAGTGGAATCACACGGACATTTATGCCAACTATGATCCAGAGGCTAGCT
ATGATTTTAATGATAATGACCATGATCCATTTCCCCGATATGATCCCACAAACGA
GAACAAACACGGGACCAGATGTGCAGGAGAAATTGCCATGCAAGCAAATAATCAC
AAATGCGGGGTTGGAGTTGCATACAATTCCAAAGTTGGAGGCATAAGAATGCTGG
ATGGCATTGTGACGGATGCTATTGAGGCCAGTTCAATTGGATTCAATCCTGGACA
CGTGGATATTTACAGTGCAAGCTGGGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.