Search our product database

Search options:
Product name: mPou5f1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MU-08135-1
Sigma Product ID: EMU081351
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000024406
Ensembl Transcript ID: ENSMUST00000025271
Gene coordinates (GRCm38): 17:35506018-35510772
MGI Alias: Oct-3, Oct-3/4, Oct3/4, Oct-4, Oct4, Otf-3, Otf3, Otf3g, Otf3-rs7, Otf-4, Otf4
MGI ID: MGI:101893
MGI Symbol: Pou5f1
NCBI gene: 18999
RefSeq mRNA: NM_001252452, NM_013633
Sequence:AGAGGGAACCTCCTCTGAGCCCTGTGCCGACCGCCCCAATGCCGTGAAGTTGGAG
AAGGTGGAACCAACTCCCGAGGAGTCCCAGGACATGAAAGCCCTGCAGAAGGAGC
TAGAACAGTTTGCCAAGCTGCTGAAGCAGAAGAGGATCACCTTGGGGTACACCCA
GGCCGACGTGGGGCTCACCCTGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACC
ACCATCTGTCGCTTCGAGGCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGC
GGCCCCTGCTGGAGAAGTGGGTGGAGGAAGCCGACAACAATGAGAACCTTCAGGA
GATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCGAACTAGCATT
GAGAACCGTGTGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCT
CCCTACAGCAGATCACTCACATCGCCAATCAG
Product name: mPou5f1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MU-08135-1
Sigma Product ID: EMU081351
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000024406
Ensembl Transcript ID: ENSMUST00000025271
Gene coordinates (GRCm38): 17:35506018-35510772
MGI Alias: Oct-3, Oct-3/4, Oct3/4, Oct-4, Oct4, Otf-3, Otf3, Otf3g, Otf3-rs7, Otf-4, Otf4
MGI ID: MGI:101893
MGI Symbol: Pou5f1
NCBI gene: 18999
RefSeq mRNA: NM_001252452, NM_013633
Sequence:AGAGGGAACCTCCTCTGAGCCCTGTGCCGACCGCCCCAATGCCGTGAAGTTGGAG
AAGGTGGAACCAACTCCCGAGGAGTCCCAGGACATGAAAGCCCTGCAGAAGGAGC
TAGAACAGTTTGCCAAGCTGCTGAAGCAGAAGAGGATCACCTTGGGGTACACCCA
GGCCGACGTGGGGCTCACCCTGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACC
ACCATCTGTCGCTTCGAGGCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGC
GGCCCCTGCTGGAGAAGTGGGTGGAGGAAGCCGACAACAATGAGAACCTTCAGGA
GATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCGAACTAGCATT
GAGAACCGTGTGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCT
CCCTACAGCAGATCACTCACATCGCCAATCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.