Search our product database

Search options:
Product name: hTERF2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04299-1
Sigma Product ID: EHU042991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132604
Ensembl Transcript ID: ENST00000254942
Gene coordinates (GRCh38): 16:69355561-69408571
HGNC Alias: TRBF2, TRF2
HGNC ID: HGNC:11729
HGNC Symbol: TERF2
NCBI gene: 7014
RefSeq mRNA: NM_005652
Sequence:CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGG
CTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAG
CAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAAC
TCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAAC
CCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAA
TGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAG
GCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTG
TAGAAGAAAGCGAGTGGGTCA
Product name: hTERF2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04299-1
Sigma Product ID: EHU042991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132604
Ensembl Transcript ID: ENST00000254942
Gene coordinates (GRCh38): 16:69355561-69408571
HGNC Alias: TRBF2, TRF2
HGNC ID: HGNC:11729
HGNC Symbol: TERF2
NCBI gene: 7014
RefSeq mRNA: NM_005652
Sequence:CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGG
CTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAG
CAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAAC
TCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAAC
CCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAA
TGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAG
GCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTG
TAGAAGAAAGCGAGTGGGTCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.