Search our product database

Search options:
Product name: MNC-00018-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00018-1
Species: Mus musculus
Sequence:GCTTGCTTTTTGCAACCATTATCTATGCATACTGCATGACATATGTACAAGAACC
TTCATGTCATAACTACACCATCAGGGTAAACTGAAGAAAGCACATGGACTTGTCA
AGTCAGAAGCTGGCAATTGCAAAGTTAAACTCAGTAATTAAAAAGACATTAAAGA
TTTTAGCCCAAAGGCAAGGCTCAAGGCCTCAAAGCTCAAGGATGCTCTTGATTGC
CACAAAATTCAGAATCAAGATTTCTTGTCTCTCCATGAGCCCAAACTTACC
Product name: MNC-00018-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00018-1
Species: Mus musculus
Sequence:GCTTGCTTTTTGCAACCATTATCTATGCATACTGCATGACATATGTACAAGAACC
TTCATGTCATAACTACACCATCAGGGTAAACTGAAGAAAGCACATGGACTTGTCA
AGTCAGAAGCTGGCAATTGCAAAGTTAAACTCAGTAATTAAAAAGACATTAAAGA
TTTTAGCCCAAAGGCAAGGCTCAAGGCCTCAAAGCTCAAGGATGCTCTTGATTGC
CACAAAATTCAGAATCAAGATTTCTTGTCTCTCCATGAGCCCAAACTTACC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.