Search our product database

Search options:
Product name: MNC-00103-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00103-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000097180
Ensembl Transcript ID: ENSMUST00000181574
Gene coordinates (GRCm38): 5:23850597-23855038
MGI ID: MGI:1914444
MGI Symbol: 2700038G22Rik
RefSeq ncRNA: NR_045040, NR_045042
Sequence:GCAGCCACCAAAACAAGATTACTAGTTCTCAGAAAAAATTTCCTGCCCTTCCCTG
CACTGAATTCCAAAGAAAACCACAAAGTGCCCTGATCTTGCCACCAAAATTCCCT
GAGATACTAATTAGCTGACCAATGAATTTACAAATATATTGCTGCTTTGCTGACC
AATCACAATATGACTATTCAACCCTCCATAAAAAGAGTATAAAAAGAGCTGTGCT
TGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTC
Product name: MNC-00103-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00103-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000097180
Ensembl Transcript ID: ENSMUST00000181574
Gene coordinates (GRCm38): 5:23850597-23855038
MGI ID: MGI:1914444
MGI Symbol: 2700038G22Rik
RefSeq ncRNA: NR_045040, NR_045042
Sequence:GCAGCCACCAAAACAAGATTACTAGTTCTCAGAAAAAATTTCCTGCCCTTCCCTG
CACTGAATTCCAAAGAAAACCACAAAGTGCCCTGATCTTGCCACCAAAATTCCCT
GAGATACTAATTAGCTGACCAATGAATTTACAAATATATTGCTGCTTTGCTGACC
AATCACAATATGACTATTCAACCCTCCATAAAAAGAGTATAAAAAGAGCTGTGCT
TGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.