Search our product database

Search options:
Product name: MNC-00104-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00104-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000044465
Ensembl Transcript ID: ENSMUST00000179474
Gene coordinates (GRCm38): 7:105371211-105400054
MGI Alias: 4632419K20Rik, 6530415H11Rik
MGI ID: MGI:1921599
MGI Symbol: Fam160a2
NCBI gene: 74349
RefSeq mRNA: NM_001242363, NM_199009
Sequence:TTTGGGCCATATCTTTCTGGGATTTGTTTCCATGTGGCACCATTCTGTGGTTATC
TTTGGAAAGATGTTCTGATTGCCTTGAGGATATGAGAGTGATGTGTATGGAGATA
GAAAATAAGTAGGACTTTATGCAGAAAACATGGATTCTTTGCATGAATCTCTTGG
TAGCATAAAGTAGCAGTGACAGTAAAGATATAGAGTGATAAAGATCCCTAATGGT
CTCTTGCTTCAGGCTGCAGGGATAACTATACACACTCTTGATGCTTTAGTTTAAA
CTTTTTGGGATAAATATGTAAGAAAGCTGAGAATTTTTAAGTTTACAGAAAGAAA
GGAAATGATACTTCATATGTTTAGGAACATCACCATTGAAATTCAGGGCAG
Product name: MNC-00104-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00104-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000044465
Ensembl Transcript ID: ENSMUST00000179474
Gene coordinates (GRCm38): 7:105371211-105400054
MGI Alias: 4632419K20Rik, 6530415H11Rik
MGI ID: MGI:1921599
MGI Symbol: Fam160a2
NCBI gene: 74349
RefSeq mRNA: NM_001242363, NM_199009
Sequence:TTTGGGCCATATCTTTCTGGGATTTGTTTCCATGTGGCACCATTCTGTGGTTATC
TTTGGAAAGATGTTCTGATTGCCTTGAGGATATGAGAGTGATGTGTATGGAGATA
GAAAATAAGTAGGACTTTATGCAGAAAACATGGATTCTTTGCATGAATCTCTTGG
TAGCATAAAGTAGCAGTGACAGTAAAGATATAGAGTGATAAAGATCCCTAATGGT
CTCTTGCTTCAGGCTGCAGGGATAACTATACACACTCTTGATGCTTTAGTTTAAA
CTTTTTGGGATAAATATGTAAGAAAGCTGAGAATTTTTAAGTTTACAGAAAGAAA
GGAAATGATACTTCATATGTTTAGGAACATCACCATTGAAATTCAGGGCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.