Search our product database

Search options:
Product name: MNC-00114-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00114-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000030259
Ensembl Transcript ID: ENSMUST00000058538, ENSMUST00000111704
Gene coordinates (GRCm38): 6:145746748-145821079
MGI Alias: 5133400D11Rik, mHoj-1
MGI ID: MGI:1918573
MGI Symbol: Rassf8
NCBI gene: 71323
Sequence:GGACATTGCCTTTGACAGGTTAGGCCTTAATGTATATTAAACGATGCTCTGTGTG
CTTCCCAAACACAAGCCTGTCTTGATCGGTAGATACTGTGGCGAGGCTAGCTCGT
GAGTATTCCTTTTGTATCACGCCAGTGTTTTAAAGTTGTGTGTTCGTATGTCTGC
TGTGGTATTTTTAAGTTCTGGGAGAAGCCTGCTGGCCGTGTCAGCTCACGGCCAT
CAGTAGTTACTCAGTATTGCTGCTCCACGTTTCCCAGTGCACCTTCCATGCCAGG
GCAGTGGCTGCGTGCGTGCAAGCCGCGGGAGCGCCTTCCCGCTCATTTTATATGT
ATTTATAGAAACCAAATGACCGCAGAT
Product name: MNC-00114-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00114-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000030259
Ensembl Transcript ID: ENSMUST00000058538, ENSMUST00000111704
Gene coordinates (GRCm38): 6:145746748-145821079
MGI Alias: 5133400D11Rik, mHoj-1
MGI ID: MGI:1918573
MGI Symbol: Rassf8
NCBI gene: 71323
Sequence:GGACATTGCCTTTGACAGGTTAGGCCTTAATGTATATTAAACGATGCTCTGTGTG
CTTCCCAAACACAAGCCTGTCTTGATCGGTAGATACTGTGGCGAGGCTAGCTCGT
GAGTATTCCTTTTGTATCACGCCAGTGTTTTAAAGTTGTGTGTTCGTATGTCTGC
TGTGGTATTTTTAAGTTCTGGGAGAAGCCTGCTGGCCGTGTCAGCTCACGGCCAT
CAGTAGTTACTCAGTATTGCTGCTCCACGTTTCCCAGTGCACCTTCCATGCCAGG
GCAGTGGCTGCGTGCGTGCAAGCCGCGGGAGCGCCTTCCCGCTCATTTTATATGT
ATTTATAGAAACCAAATGACCGCAGAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.