Search our product database

Search options:
Product name: MNC-00127-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00127-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000102101
Ensembl Transcript ID: ENSMUST00000186480
Gene coordinates (GRCm38): 16:55973268-55974617
MGI Alias: 2310061J03Rik
MGI ID: MGI:1913641
MGI Symbol: Zbtb11os1
RefSeq ncRNA: NR_027965
Sequence:ACATGTTGGAAGAGGGAACGCGCTCTCTCGGGCAGATACGGGGGTCCTCAGCAGA
CATCTTAAGTCTTGGCAGGGCCCTCCCCCACCGCCCTCCCTTTCCTTTCCCACGC
TCTCTGTAAAGCCACGTGTTTGAGCGGTTCGCTGTTTGTTTCCCTGAGACCCTCC
CCGTAAACGGTAACTGAGTCAGTTGTTCTGTATACTCTGAGACTAGATATACCAG
ATACCGCCGAGTTTGAAACTGTAGCAATTGATTGCCACTGTCTGAGC
Product name: MNC-00127-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00127-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000102101
Ensembl Transcript ID: ENSMUST00000186480
Gene coordinates (GRCm38): 16:55973268-55974617
MGI Alias: 2310061J03Rik
MGI ID: MGI:1913641
MGI Symbol: Zbtb11os1
RefSeq ncRNA: NR_027965
Sequence:ACATGTTGGAAGAGGGAACGCGCTCTCTCGGGCAGATACGGGGGTCCTCAGCAGA
CATCTTAAGTCTTGGCAGGGCCCTCCCCCACCGCCCTCCCTTTCCTTTCCCACGC
TCTCTGTAAAGCCACGTGTTTGAGCGGTTCGCTGTTTGTTTCCCTGAGACCCTCC
CCGTAAACGGTAACTGAGTCAGTTGTTCTGTATACTCTGAGACTAGATATACCAG
ATACCGCCGAGTTTGAAACTGTAGCAATTGATTGCCACTGTCTGAGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.