Search our product database

Search options:
Product name: MNC-00134-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00134-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000086015
Ensembl Transcript ID: ENSMUST00000146868
Gene coordinates (GRCm38): 11:95858865-95861044
MGI ID: MGI:1921156
MGI Symbol: 4833417C18Rik
RefSeq ncRNA: NR_045187
Sequence:GCTTCAAGGATGCTCTGGACTATGTATTGTTTATTATAATATAGTGAGGCTTGGC
CCCATAATGATGGCTATTGTATAAGTCCTCTACAAGAGTTTAAGAAATAACCTGT
GTGCGAGGCTCAGATAAGCACTAGGGACACCAGGAATGTTAACTACACAGGAATG
TCTGTTTAGTGAGAGAGATGTATGACGTGTCTTCTGCCCAGAAGGCTGGGAGCAG
ATGTGGGTAATGGCCTGTGACCTGAGACTGATAGGCTGAGATCTCACCAGTTCCT
CCCTGGACTCTTATCGGTGAGCATGTTTTTCTCAGTCTATAGAAACTATCTTTCT
GGAAGATGTCACATGTACTTTACAAAGAGTTCCAGTGCAGTGGTGTCCTAAGCTG
TGCTG
Product name: MNC-00134-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00134-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000086015
Ensembl Transcript ID: ENSMUST00000146868
Gene coordinates (GRCm38): 11:95858865-95861044
MGI ID: MGI:1921156
MGI Symbol: 4833417C18Rik
RefSeq ncRNA: NR_045187
Sequence:GCTTCAAGGATGCTCTGGACTATGTATTGTTTATTATAATATAGTGAGGCTTGGC
CCCATAATGATGGCTATTGTATAAGTCCTCTACAAGAGTTTAAGAAATAACCTGT
GTGCGAGGCTCAGATAAGCACTAGGGACACCAGGAATGTTAACTACACAGGAATG
TCTGTTTAGTGAGAGAGATGTATGACGTGTCTTCTGCCCAGAAGGCTGGGAGCAG
ATGTGGGTAATGGCCTGTGACCTGAGACTGATAGGCTGAGATCTCACCAGTTCCT
CCCTGGACTCTTATCGGTGAGCATGTTTTTCTCAGTCTATAGAAACTATCTTTCT
GGAAGATGTCACATGTACTTTACAAAGAGTTCCAGTGCAGTGGTGTCCTAAGCTG
TGCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.