Search our product database

Search options:
Product name: MNC-00145-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00145-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000085492
Ensembl Transcript ID: ENSMUST00000143828
Gene coordinates (GRCm38): 17:71557027-71598755
MGI Alias: 1110039F03Rik, Gm6431
MGI ID: MGI:1916039
MGI Symbol: Trmt61b
RefSeq ncRNA: NR_027953
Sequence:CATCACCGACCTTTGGAGTTTTTCAGCATGTTGGATTTTTAAACATGTTCAGGTT
GGAAAATTGAGAGTGTAATGTTAACAGTAAAGTTTAACCTTTTAAGCTGGTGTAG
GAAGTTCAGACCACACCTGAACTGGTACCTGAGATGACAGCACTGAATCTGAAGA
CAAAGAAGGATCAAATTAGAACTGACTATTATTAGTCACTACTTCAGAAAGTCTT
TTTACCTTATTTTGGTATGTTTAGTTATTACTATGATTTGTATGACTTTTACATG
TGTTTGAAAAGTAACAGAAGCTAAAGGCCATTGTACAACTGGGTAACAGTCCCG
Product name: MNC-00145-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00145-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000085492
Ensembl Transcript ID: ENSMUST00000143828
Gene coordinates (GRCm38): 17:71557027-71598755
MGI Alias: 1110039F03Rik, Gm6431
MGI ID: MGI:1916039
MGI Symbol: Trmt61b
RefSeq ncRNA: NR_027953
Sequence:CATCACCGACCTTTGGAGTTTTTCAGCATGTTGGATTTTTAAACATGTTCAGGTT
GGAAAATTGAGAGTGTAATGTTAACAGTAAAGTTTAACCTTTTAAGCTGGTGTAG
GAAGTTCAGACCACACCTGAACTGGTACCTGAGATGACAGCACTGAATCTGAAGA
CAAAGAAGGATCAAATTAGAACTGACTATTATTAGTCACTACTTCAGAAAGTCTT
TTTACCTTATTTTGGTATGTTTAGTTATTACTATGATTTGTATGACTTTTACATG
TGTTTGAAAAGTAACAGAAGCTAAAGGCCATTGTACAACTGGGTAACAGTCCCG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.