Search our product database

Search options:
Product name: MNC-00169-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00169-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000026361
Ensembl Transcript ID: ENSMUST00000018337
Gene coordinates (GRCm38): 1:143598800-143702893
MGI Alias: 8430414L16Rik, C130030P16Rik, Hrpt2
MGI ID: MGI:2384876
MGI Symbol: Cdc73
NCBI gene: 214498
RefSeq mRNA: NM_145991
Sequence:TCCTTCACCCAAAGTTGACCATTTTATCTGGGTAGCCAGAGGAAAATAAGTTGAT
CCTTGTTCAATAGGTGAAGAAATTATCCTTGTGAATATATGAGAAGAAAGCACTC
CAGACAGTGAAGAGTCTGAAGCCTTCCGCTAGGATCATACTTACTATTTTAAGGA
CTGACAAGGAGGCCACTGGGCTTAGTGAGGCAGCAGGAATGGAAATGGGAGAGCA
GATGCACCAGGGAACAAGGTTCTGGGATGGCTTA
Product name: MNC-00169-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00169-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000026361
Ensembl Transcript ID: ENSMUST00000018337
Gene coordinates (GRCm38): 1:143598800-143702893
MGI Alias: 8430414L16Rik, C130030P16Rik, Hrpt2
MGI ID: MGI:2384876
MGI Symbol: Cdc73
NCBI gene: 214498
RefSeq mRNA: NM_145991
Sequence:TCCTTCACCCAAAGTTGACCATTTTATCTGGGTAGCCAGAGGAAAATAAGTTGAT
CCTTGTTCAATAGGTGAAGAAATTATCCTTGTGAATATATGAGAAGAAAGCACTC
CAGACAGTGAAGAGTCTGAAGCCTTCCGCTAGGATCATACTTACTATTTTAAGGA
CTGACAAGGAGGCCACTGGGCTTAGTGAGGCAGCAGGAATGGAAATGGGAGAGCA
GATGCACCAGGGAACAAGGTTCTGGGATGGCTTA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.