Search our product database

Search options:
Product name: MNC-00173-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00173-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000062078
Ensembl Transcript ID: ENSMUST00000233645
Gene coordinates (GRCm38): 17:10202601-10319854
MGI Alias: 1110003F05Rik, l(17)-1Wis, l17Wis1, QkI
MGI ID: MGI:97837
MGI Symbol: Qk
NCBI gene: 19317
RefSeq mRNA: NM_001159517
Sequence:GGTGCTCAATGCTGAATCAAACTGGTCAAACTGAAGCACAATACACTCCTTATTG
TTTCTGCTGCACTAATTGCCAGGGGTGGGAGAGGAGGAGCAGCAACTAATCCATG
GTAGGCAGATGTGGGCAGGAGGTGCTGTATGTAGTGAGTGGGCAAAGAGGAGCTC
AACATTACTTGAAGTTTGCTATCCCCTGGAGAGATACTGGCCAGCACTGGGACAG
TCTCAGAACCAGGGTAAAATTAATTTATATCTCTTTAAAGGTTCTATTATTACAA
AGTTTTGAGCCAAATATATCTATATAACCTATGTTATATTGGTATGTATAAAATT
TTGACTTGTAGAAGTTGTATATATAGGGATATACATATATATGTATGTGTGCATG
TATATATATGGATATATATATAGATATAGATATTCCTGAATCATACACGAATGGG
AAACTGCA
Product name: MNC-00173-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00173-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000062078
Ensembl Transcript ID: ENSMUST00000233645
Gene coordinates (GRCm38): 17:10202601-10319854
MGI Alias: 1110003F05Rik, l(17)-1Wis, l17Wis1, QkI
MGI ID: MGI:97837
MGI Symbol: Qk
NCBI gene: 19317
RefSeq mRNA: NM_001159517
Sequence:GGTGCTCAATGCTGAATCAAACTGGTCAAACTGAAGCACAATACACTCCTTATTG
TTTCTGCTGCACTAATTGCCAGGGGTGGGAGAGGAGGAGCAGCAACTAATCCATG
GTAGGCAGATGTGGGCAGGAGGTGCTGTATGTAGTGAGTGGGCAAAGAGGAGCTC
AACATTACTTGAAGTTTGCTATCCCCTGGAGAGATACTGGCCAGCACTGGGACAG
TCTCAGAACCAGGGTAAAATTAATTTATATCTCTTTAAAGGTTCTATTATTACAA
AGTTTTGAGCCAAATATATCTATATAACCTATGTTATATTGGTATGTATAAAATT
TTGACTTGTAGAAGTTGTATATATAGGGATATACATATATATGTATGTGTGCATG
TATATATATGGATATATATATAGATATAGATATTCCTGAATCATACACGAATGGG
AAACTGCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.