Search our product database

Search options:
Product name: MNC-00174-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00174-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000042496
Ensembl Transcript ID: ENSMUST00000215499
Gene coordinates (GRCm38): 9:31280538-31381723
MGI Alias: LOC382066, tristanin
MGI ID: MGI:2682952
MGI Symbol: Prdm10
NCBI gene: 382066
Sequence:GGTTTCCCACCACTGAGCTACAACTCCAGCCCCCACCTCGCACTCTGGTTCCCAG
CATTGGGCGTATTTTAGTACTTTCGATCTTTCGATGCTGTCTTAAAAATGAAGAT
TCTTTAAGGTTGGGTAGAAAGGTGGCCTTTCTTACTTCTAAGCATTTTAAACTTT
AAGCCTGTCATTAACTCACCCAGACCTTGATATAAGATAACCAACTTCCCACTGA
GGGCAAAAATGAAAATAAAGGGACCATTGTAATAGGCTGAGATAAAGGGATGGGT
GTGAAGG
Product name: MNC-00174-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00174-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000042496
Ensembl Transcript ID: ENSMUST00000215499
Gene coordinates (GRCm38): 9:31280538-31381723
MGI Alias: LOC382066, tristanin
MGI ID: MGI:2682952
MGI Symbol: Prdm10
NCBI gene: 382066
Sequence:GGTTTCCCACCACTGAGCTACAACTCCAGCCCCCACCTCGCACTCTGGTTCCCAG
CATTGGGCGTATTTTAGTACTTTCGATCTTTCGATGCTGTCTTAAAAATGAAGAT
TCTTTAAGGTTGGGTAGAAAGGTGGCCTTTCTTACTTCTAAGCATTTTAAACTTT
AAGCCTGTCATTAACTCACCCAGACCTTGATATAAGATAACCAACTTCCCACTGA
GGGCAAAAATGAAAATAAAGGGACCATTGTAATAGGCTGAGATAAAGGGATGGGT
GTGAAGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.