Search our product database

Search options:
Product name: MNC-00192-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00192-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000070476
Ensembl Transcript ID: ENSMUST00000094251
Gene coordinates (GRCm38): 2:178414524-178424428
MGI Alias: 9030418K01Rik
MGI ID: MGI:1918782
MGI Symbol: Fam217b
NCBI gene: 71532
RefSeq mRNA: NM_001081289
Sequence:TTATGCGGATCCTTTGGAAGCTTCAGGGCCAGTAAATGTAAGCATGACATCATAT
ACACGTAATACCAGCTCTAGTGCTCACTAGAGTAGCATGCTCACTAGAGCAGCAC
TGACAGGGTTTCTTTTCTGTTACACACCTGTGTGGGTCCTTTAGACCCTGACAGG
CAAGGGTGAAATTCCTTTTCCCTTGCTGGATGTGAGTCTGAGCTAAAACTGTCAC
AACTAAGGAATGCAAAGACAGTGACTCATGCATTCGTTCCCAGCACACTTAACCG
AACTTGGTTCCTGATCTAGGGACTAGAATTCATGTTCTGTGTTTAGACAGCCCTA
GAAGCCCAAAGCACGACTTTGTTTACCTCTTTGCCCAGGTTGATTGTCCGAGTTG
AGCAG
Product name: MNC-00192-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00192-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000070476
Ensembl Transcript ID: ENSMUST00000094251
Gene coordinates (GRCm38): 2:178414524-178424428
MGI Alias: 9030418K01Rik
MGI ID: MGI:1918782
MGI Symbol: Fam217b
NCBI gene: 71532
RefSeq mRNA: NM_001081289
Sequence:TTATGCGGATCCTTTGGAAGCTTCAGGGCCAGTAAATGTAAGCATGACATCATAT
ACACGTAATACCAGCTCTAGTGCTCACTAGAGTAGCATGCTCACTAGAGCAGCAC
TGACAGGGTTTCTTTTCTGTTACACACCTGTGTGGGTCCTTTAGACCCTGACAGG
CAAGGGTGAAATTCCTTTTCCCTTGCTGGATGTGAGTCTGAGCTAAAACTGTCAC
AACTAAGGAATGCAAAGACAGTGACTCATGCATTCGTTCCCAGCACACTTAACCG
AACTTGGTTCCTGATCTAGGGACTAGAATTCATGTTCTGTGTTTAGACAGCCCTA
GAAGCCCAAAGCACGACTTTGTTTACCTCTTTGCCCAGGTTGATTGTCCGAGTTG
AGCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.