Search our product database

Search options:
Product name: MNC-00210-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00210-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000087341
Ensembl Transcript ID: ENSMUST00000204759
Gene coordinates (GRCm38): 6:108577039-108660934
MGI ID: MGI:1922644
MGI Symbol: 0610040F04Rik
RefSeq ncRNA: NR_040757
Sequence:ACTGCTTGTTTGGGCTCAGTTCTCCCAGCTGGAGTCATTGTTCCAACTTATTTGT
ACGTTTTTTGAGTCTGTAAACTGGAGCTCATTCTATAGACCAAACTGGTCTTGAA
CTCAGAAATTTGGCTGCCTCTGCCTCCCAAGTGCTGAGATTGAAGGCATGCACCA
CCACGGCCCAGCAGAACTAACCCATTCTTATTGGAGCTACATCAATCCCTTTCTC
TGAGTGGACTCTACCAGGGCATAATTACTTCATCAAGGTTCTACCACCTGACCAC
ACCA
Product name: MNC-00210-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00210-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000087341
Ensembl Transcript ID: ENSMUST00000204759
Gene coordinates (GRCm38): 6:108577039-108660934
MGI ID: MGI:1922644
MGI Symbol: 0610040F04Rik
RefSeq ncRNA: NR_040757
Sequence:ACTGCTTGTTTGGGCTCAGTTCTCCCAGCTGGAGTCATTGTTCCAACTTATTTGT
ACGTTTTTTGAGTCTGTAAACTGGAGCTCATTCTATAGACCAAACTGGTCTTGAA
CTCAGAAATTTGGCTGCCTCTGCCTCCCAAGTGCTGAGATTGAAGGCATGCACCA
CCACGGCCCAGCAGAACTAACCCATTCTTATTGGAGCTACATCAATCCCTTTCTC
TGAGTGGACTCTACCAGGGCATAATTACTTCATCAAGGTTCTACCACCTGACCAC
ACCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.