Search our product database

Search options:
Product name: MNC-00222-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00222-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000054426
Ensembl Transcript ID: ENSMUST00000185681, ENSMUST00000191182
Gene coordinates (GRCm38): 3:115881581-115888130
MGI ID: MGI:1915411
MGI Symbol: A930005H10Rik
RefSeq ncRNA: NR_015487
Sequence:CAGAGGTCAAGGGTCAGGAATGGGTCCAGCTGTGCGCCTGGAAAGGACCCAGCGT
GCCCACGCTCCCGGCAAGCCAGGACTCAAACATCCCCAAAGGGCGTCCGGGCTGA
TGACGATAGCTCCCAATCGCCCTCCAGACGCACACTGGCAGGAACAACCGGAGGG
ACTTCCCTGACCGACCCCGCGTTTGCTCAGCTTTGAATTCCCGCTCTGTAGATCT
GTCGCAATTTAACCAGAAGTCACCCTGGTGAGGGGACAGTGCATGGAGCTGTTTG
AGA
Product name: MNC-00222-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00222-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000054426
Ensembl Transcript ID: ENSMUST00000185681, ENSMUST00000191182
Gene coordinates (GRCm38): 3:115881581-115888130
MGI ID: MGI:1915411
MGI Symbol: A930005H10Rik
RefSeq ncRNA: NR_015487
Sequence:CAGAGGTCAAGGGTCAGGAATGGGTCCAGCTGTGCGCCTGGAAAGGACCCAGCGT
GCCCACGCTCCCGGCAAGCCAGGACTCAAACATCCCCAAAGGGCGTCCGGGCTGA
TGACGATAGCTCCCAATCGCCCTCCAGACGCACACTGGCAGGAACAACCGGAGGG
ACTTCCCTGACCGACCCCGCGTTTGCTCAGCTTTGAATTCCCGCTCTGTAGATCT
GTCGCAATTTAACCAGAAGTCACCCTGGTGAGGGGACAGTGCATGGAGCTGTTTG
AGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.