Search our product database

Search options:
Product name: MNC-00232-1 €124.00 / 20 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00232-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000036155
Ensembl Transcript ID: ENSMUST00000038361
Gene coordinates (GRCm38): 1:127205015-127488336
MGI Alias: 4930471A21Rik, 5330407H02Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV
MGI ID: MGI:894701
MGI Symbol: Mgat5
NCBI gene: 107895
RefSeq mRNA: NM_145128
Sequence:AGAAGCCGGAATGTAGCAGATATGGGAAGCAGATTTGTTTTTGCTTAGAGCTTAG
CCCATGTATTAAAGAGAATAGTGTAACCACAATGCCAAAGGACATGGTGATGTCC
CTTCCACTGTAGTTCCTGTCACAACCTTGCTGTTAAGCTCATGGCCGTTGACGTC
TGTGTCTTCAAATGGATCCTGGTTCGCTTGTTTTCT
Product name: MNC-00232-1 €221.00 / 50 µg DetailsClose
Category: Mouse esiRNA
Catalog No: MNC-00232-1
Species: Mus musculus
Ensembl Gene ID: ENSMUSG00000036155
Ensembl Transcript ID: ENSMUST00000038361
Gene coordinates (GRCm38): 1:127205015-127488336
MGI Alias: 4930471A21Rik, 5330407H02Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV
MGI ID: MGI:894701
MGI Symbol: Mgat5
NCBI gene: 107895
RefSeq mRNA: NM_145128
Sequence:AGAAGCCGGAATGTAGCAGATATGGGAAGCAGATTTGTTTTTGCTTAGAGCTTAG
CCCATGTATTAAAGAGAATAGTGTAACCACAATGCCAAAGGACATGGTGATGTCC
CTTCCACTGTAGTTCCTGTCACAACCTTGCTGTTAAGCTCATGGCCGTTGACGTC
TGTGTCTTCAAATGGATCCTGGTTCGCTTGTTTTCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.